Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10230F8
Clone ID IST10230F8
Vector VICTR76
Project tigm

Sequence tag IST10230F8BBF1
Sequence
CTTAAAGGCTGTCTTACCCATGAAAGAGAAAAGAGAGCATCGCANAGACCTTCTGACCCCGNCTGNGGGAGCCTGGGGAG
AGGAATGCCAGGGAGCCTTTCAGACCTTTCTTCCTTCCCTCCCCTCCCCCATTCAGCCTTTCTCTCTCCTCTTGTGGCTC
CTTAAAGGATAACCTAAGCTCTGCNNACNGTGGAATCCGTTCTTTCTGTCTTGNGGAAAGACTCCTAGCCGATGAANAAA
GGGGGTTTTCANANCAAGCACCGACCTGGGAGACAGGACCTCAGCTTTATCAGTAAAGGCTACTTGGCCTTGCTCGAGTC
GCTCAGTTTCTCTGANCCCAGTTATTTAACGAATGGACTCCTCCTGGTTCTCAGATNANGTNCTGGATTTCTAGGATTCA
TTGAANGGGACATCCTTTCAGACNCTNNNGAAATTCTCCAGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10230F8HMF1
Sequence
CTTAAAGGCTGTCTTACCCATGAAAGAGAAAANANAGCATCGCANAGACCTTCTGACCCCGCCTGTGGGAGCCTGGGGAG
AGGAATGCCAGGGAGCCTTTCAGACCTTTCTTCCTTCCCTCCCCTCCCCCATTCAGCCTTTCTCTCTCCTCTTGTGGCTC
CTTAAAGGATAACCTAAGCTCTGCAAACAGTGGAATCCGTTCTTTCTGTCTTGTGGAAAGACTCCTAGCCGATGAAGAAA
GGGGGTTTTCANAGCAAGCACCGACCTGGGAGACAGGACCTCAGCTTTATCAGTAAAGGCTACTTGGCCTTGCTCGAGTC
GCTCANTTTCTCTGANCCCAGTTATTTAACGAATGGACTCCTCCTGGTTCTNANATAAAGTACTGGATTTCTAGGATTCA
TTGAAAGGGACATCCTTTCAGACACTCANGAAATTCTCCAGANGGATGGGGAAGAAAGATGGAGTAAACATGAAAAAGTA
ANGGTGTGTATGCACCCAN
Sequence Type genomic DNA
Unitrap ID UNI16635

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 50149154..50149651 476
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073207 (6330534C20Rik) NM_001034059 RIKEN cDNA 6330534C20 gene Gene [Source:MGI Symbol;Acc:MGI:3588225]

 
Come back to gene ENSMUSG00000073207


For any suggestions or comments, please send an email to unitrap@crg.es