Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12240F3
Clone ID IST12240F3
Vector VICTR76
Project tigm

Sequence tag IST12240F3HMF1
Sequence
AAAGAAGCCCAAGGTTGCCATCGCTTCCACCAACAAGAGGCCGAAGAAGGAGACGAAGAAGAAGCGATAGAATCCTAGAA
TCCGAGGCCGAGGAGCCCAAGGCTGCAGCCTCGGGGACAGCCCTCCTGGGAACCAGCATCCTGTTTGCTCTCACAGACTG
TCTCTGTCCTCGGCTCANAGTCTGAGAGGATTGAAACTCCCTCTGACTACAGAGCTCTGAACAGTCCTTAGGCTCCAGCT
GTGCAGACCACCACTTCCTCTTCTTTCTCTCTGTGGTGCACGGGAGATTCTCAAGAGCAAACACTGCCCCGAGGGTTCCG
AGTCAGGTCAGGCTCACAGGGCAACGTATTCACATTAGTCCTGGAGTCCAGTGGGCTCGAGACCTGAGCCTCACTAACAG
CATGGAATTGTTGCCTAAGGCTGCAGGCATACCCTCTCCCTGTGCTTGGGCCACATTTGTCTTTTGTGAGCACAGAACTT
CACACGTGTTN
Sequence Type genomic DNA
Unitrap ID UNI1604

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 157221684..157222173 488
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063019 (Manbal) NM_026968 mannosidase, beta A, lysosomal-like Gene [Source:MGI (curated);Acc:Manbal-001]

 
Come back to gene ENSMUSG00000063019


For any suggestions or comments, please send an email to unitrap@crg.es