Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13177D2
Clone ID IST13177D2
Vector VICTR74
Project tigm

Sequence tag IST13177D2BBF1
Sequence
GTTGTACGGCTGTGAAGAAGTTATTCTCTGGATTANAGAGAAAGCTGTGCAAGACAGAGCG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 72284859..72284918 58
NO GENE  


Sequence tag IST13177D2HMF1
Sequence
GCTTTGGCAGTTCCCAGGTGGTACAGACTCTCACCTAAGCAGACTAAATTCCTAAGTTCCTTGGAGTCCCGGGACCAAGA
TGGCGACCGCTGCTGCTGTGGCTTANGTCNCCTCCCCANCCGGGCGGGCACCTGTCCTCTGGTCCGGAAGGTGGCCGGCT
GTCCCCGGCCCACNCAGGGTGCTNCCTCANCGCCTCTGTGCTTCTGCCTGTTCNANAANCTGTCAGGTTN
Sequence Type genomic DNA
Unitrap ID UNI30811 UNI31343 UNI31345 UNI31952

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 21293150..21293378 211
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 50427564..50427792 211
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 21687572..21687800 211
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051341 (Zfp52) NM_144515 zinc finger protein 52 Gene [Source:MGI Symbol;Acc:MGI:99199]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 57592122..57592350 211
 
EST/CDNA Est Name
  BY102783.1 - BY102771.1 - BQ257935.1 - BX512183.1 - AW320348.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 4725039..4725267 211
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022181 (C6) NM_016704 complement component 6 Gene [Source:MGI Symbol;Acc:MGI:88233]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 6882968..6883196 211
 
EST/CDNA Est Name
  BX512183.1 - AW320348.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 43846224..43846452 211
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 38066518..38066746 211
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 38049012..38049240 211
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 100788456..100788684 211
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 25662012..25662240 211
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 75681283..75681511 211
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 24235283..24235511 211
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 70524303..70524531 211
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 16750008..16750236 211
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 81554221..81554449 211
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 5055132..5055360 211
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 22111069..22111297 211
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 14209764..14209992 211
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026712 (Mrc1) NM_008625 mannose receptor, C type 1 Gene [Source:MGI (curated);Acc:Mrc1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 11616430..11616658 211
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000057715 (A830018L16Rik) NM_177173 RIKEN cDNA A830018L16 gene Gene [Source:MGI Symbol;Acc:MGI:2444149]

 
Come back to gene ENSMUSG00000057715


For any suggestions or comments, please send an email to unitrap@crg.es