Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14909B7
Clone ID IST14909B7
Vector VICTR76
Project tigm

Sequence tag IST14909B7BBF1
Sequence
GTTCAATATCTGTACCCCATAAACAGAATGTGGTATTGTATGACTGTATTCTGCACAACTCTGTACAACAGTATAACACT
CCAAAGACAAAAAGTTCAAGGTCACCTTCATTTACATTTCAAGTGAGAATATAGCCTANAATACAAAAGACTCTGCCTCA
GCCATAAAGGAATGAGGGCACAAAAGCAAACTGTACCTATCAAAGATTTAAAGTGATAACACTTTAAAATAGTAGGCCAT
TATATTCCAGGAGCCCTGAAAGATGCTTAAGAAAAAAGGATTCCAAGAATTTTCAAGGAGTTTTCTAGAAGTCTATCAAA
AACAAACAGGCATAAGTACAATTAATAATATAATATTTATAATTATATTGATATTATAATAATTATAATGTAATGAANTA
TGACAACNCCAGANAACATGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 65939616..65940036 413
 
EST/CDNA Est Name
  DT904976.1 - DT924641.1


Sequence tag IST14909B7HMR1
Sequence
AACTTGTAGGATTATGTCATTCTANGCAAGTGTTCTACCAACTGAGCTACATCCTAACCCTACTGTACTGGGGTTGTTTT
TTNTTNGTTG
Sequence Type genomic DNA
Unitrap ID UNI13226

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 65940034..65940122 83
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029203 (Hip2) NM_016786 ubiquitin-conjugating enzyme E2K (UBC1 homolog, yeast) Gene [Source:MGI (curated);Acc:Hip2-003]


Sequence tag IST14909B7HMF1
Sequence
GTTCAATATCTGTACCCCATAAACAGAATGTGGTATTGTATGACTGTATTCTGCACAACTCTGTACAACAGTATAACACT
CCAAAGACAAAAAGTTCAAGGTCACCTTCATTTACATTTCAAGTGAGAATATAGCCTANNNTACAAAAGACTCTGCCTCA
NCCATAAAGGAATGAGGGCACAAAANCANACTGTNCCTATCAAAGATTTAANGTGATANCANTTTNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000029203


For any suggestions or comments, please send an email to unitrap@crg.es