Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10061D3
Clone ID IST10061D3
Vector VICTR75
Project tigm

Sequence tag IST10061D3BBF1
Sequence
CTTAGTGCTGGGACCCACTTACAGACATGCCCCCACCCTGCGTTAAACTAAAGAATCTGAAACTATAGTGACCACTACGT
TAGCCAGTTGCGGAAAGCTGGAGGGGAACCAGCTTCAACGCGTTTCTGATTATTACCAACCCAGAGTGCAGGAGGAAGAT
CCTAAGTTTCCCGGTTTCTGGCTGTTTTGTGGCTGAGGATATAGAGTACAGTGCTAGAACACTTGCAGGCTCAGGGCCTT
GGACTGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 53114667..53114916 248
 
EST/CDNA Est Name
  CF928910.1


Sequence tag IST10061D3HMR1
Sequence
NTGATGGCTATCTTGATNATCCCTGCCTGCTACCACCACTCACTCATCTTACCCAGCATCCTCCTCTATATCCTCTACAA
AACTTGCCAGGCTGCTTCATCATAGCTCTTCTGTGCTTCCGAGGAGGGGGCTACCTAGAAAGCTGGGCTCCACCCCTCAT
ACAGCATGCCTGCAAGCCCTTAATGTGCCTGAGACTCCAAAGAGGGCACCAAGAGATGTCCTCATACCCCAGTTTGAGGG
CCCCTTGATAAGGCTTTCCTGGTGGTCTTTTGTGGACCTAGGGTTCCGTTTCCCCTAATGAAGTATCCCGGGAGTGGGAT
TATTTTCTGAATGCATGGTGAGCTTTCTTTTCCTTTTCAATTTATTTTTAGCATTAGCAGGTATGTGTGGCACATGTGAA
GGTCAGGACAACTTTGAACTCAGTTCTCTCCTTCCNCCTTTATGTGGGCTCCAGGGATTGNNCNGGTTGCTTTATCCNCA
ANCNNNNTTNCCACCCCATACAAAGANTTNCCAANNCC
Sequence Type genomic DNA
Unitrap ID UNI1301

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 38944086..38944598 485
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005103 (Wdr1) NP_035845 WD repeat domain 1 Gene [Source:MGI Symbol;Acc:MGI:1337100]

 
Come back to gene ENSMUSG00000005103


For any suggestions or comments, please send an email to unitrap@crg.es