Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13188B6
Clone ID IST13188B6
Vector VICTR74
Project tigm

Sequence tag IST13188B6HMF1
Sequence
GAGGCTACGCGCTCAGCGCCGCGTACGCGCACCCTACCCAGTGGTGGAAGGTATGCACATCCTTGGGAGACAGGAATTTT
GGGGTGCTGCCTAATCCTTGTCC
Sequence Type genomic DNA
Unitrap ID UNI21331

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 87584386..87584487 102
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000008167 (Fbxw9) NM_026791 F-box and WD-40 domain protein 9 Gene [Source:MGI (curated);Acc:Fbxw9-001]


Sequence tag IST13188B6BBF1
Sequence
NAGGCTACGCGCTCAGCGCCGCGTACGCGCACCCTACCCAGTGGTGGAAGGTATGCACATCCTTGGGAGACAGGAATTTT
GGGGTGCTGCCTAATCCTTGTCGACCACAAGGCCACTTGGTTTCCTCAGGAAGTGCTCTGGACCTGGGATTTCTAAACTT
AAAATCCAAAGATTTCCGGGTTTGCGCTTTGTTAGCACAAAGGCCCTAGCCCAAGAATTCCCAAGCTTTGGAAACAACTT
GAGGCACAAGCAGCAACTANCATAACAAAGCCTTTGACCCATGGAGTGTTGATCCAGGATTCGTTAAGAGGTTCTGAATT
TCTAGACTCCCGATTGGGATCATTAATACNAGTAATCTTTCAGTTCTAGGTCTANCCTGTNACCTTTTCTANNNNANTTN
ANNANTTTGGGGCANGTTCTCATGTAGCTCCN
Sequence Type genomic DNA
Unitrap ID UNI21331

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 87584387..87584816 402
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000008167 (Fbxw9) NM_026791 F-box and WD-40 domain protein 9 Gene [Source:MGI (curated);Acc:Fbxw9-001]

 
Come back to gene ENSMUSG00000008167


For any suggestions or comments, please send an email to unitrap@crg.es