Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10082H8
Clone ID IST10082H8
Vector VICTR75
Project tigm

Sequence tag IST10082H8HMF1
Sequence
CTTCCAACTTGCAGGAGCTTCCCTAGGCTGACTGGAACTGGAGTGAGAGGCTGTGGGCCAATGCTGCTAGTTGGCCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 31715533..31715609 77
NO GENE  


Sequence tag IST10082H8BBR1
Sequence
TTATACAACACTCCCTTCCCCCGTACATGAGTTTTTGAACGCAAGTTCTAGGCTCATCTTATATTCCTGCTAAACACCCA
TTGCTGTTGGTACTGGGTCCCTTTCAGTGGATGGAACAAATATGTGTGGGTAGATATCACACATGGATATCTACCTCTGT
ATTTCTCTGCATTAAAACCACGCATGCGCACTAAAATCTCCACTTCCCCAGCACCATAGAATGCCCTGAACCCACCCTGT
TCTCTGTCCCTGGGAAGTCTGGCTCTAGTAGCTCTTGTCTTTTCCTTTCCCTGCTGGAATCTCCTGGGTTTTTTGTTTTT
GTTTTTGTTTTTTTGGGTGTTTTGTTTTGTTTTGTTTTGTTTGAGACAGGGTTTCTCTGTACAGCCCTGGCTGTCCTGGA
ACTCATTTTGTAGACCAGGCTGGCCTTGAATTTAGAAATCCTCCTGCCTCTGCCTCCCAAGTGCTGGGATTAAAGGCGTG
CGCTGCCGCCGCCGCCGCCGCCGCCACCACCACCCAGCCTCCTGGTCATAGAAAAGTAAAAACAGAACATAAACTGCTCC
AGCATATTCAGTCCTTTTCTACATTGACCCAAAGTAGGCCCT
Sequence Type genomic DNA
Unitrap ID UNI4724

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 31715610..31716208 595
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006705 (Pknox1) NM_016670 Pbx/knotted 1 homeobox Gene [Source:MGI Symbol;Acc:MGI:1201409]

 
Come back to gene ENSMUSG00000006705


For any suggestions or comments, please send an email to unitrap@crg.es