Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14813A12
Clone ID IST14813A12
Vector VICTR76
Project tigm

Sequence tag IST14813A12HMR1
Sequence
TCNTACTGTGTGACAGGGAGGCTTTCAAGTATGTCCTTAACTGAAAGATCCCTGGTACCTTTGGAAAGCCCCGTTTCATC
CCCCAATATCGTTCATTGGTGCTGCGGATATGTCTGCTAAAACAGTGGGCTCTGGCTGCAGTGAAAGACTATCTCAAAAT
ATAAGATGGACAACTCCAAAAGATCCAACACCCTCATCTAAGACTGCCAGAACCTACGCACACGCGCAAGCACGCAAACA
CGCATGCGTACACANNANATAATTCTTAANATAATNNTAAATTGGCCTGGGATTGCGGAAAAGCCACTCAAACCTTGAAC
CCTGGCCTCCACCCAGCACCCCAGCTGCATTTCTACTGAGCCCTAATCTTGTTTGTCTCTGANGACAGGATGCCTAAAAG
TCAGAACCCCTCCCTCCGNANGANAATNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 53743542..53743969 402
NO GENE  


Sequence tag IST14813A12BBF1
Sequence
ATGACCNGCCAGGTAGAGCAAATAATATGTCCTTCATGTTTGGTCTCCATTTCGTAGCCAAGATCACTGCACAGCAGCTA
AATAAGTCAGCTTTATTCTTTTGTACAGAGCTAAGGAGGTGTGAGTCTTTAGGGAAACACGATTTATATCAAGTATTGTA
AACTCACTCTTGTTCTATTGCTGTTTGGGGGTGTTGCTTGTTTCATGAAGCTAGTGTTGTGGACTGTCTTTGATCTGACC
ATTCCCTGGGGAATGCAAAAGCAAAATGTTTGAGTTGTAGTTACNACCAGCAGAAGCNAATCTGAAGTCCCACCCCCTAT
TATTANTATTATTATTAATTATTAAN
Sequence Type genomic DNA
Unitrap ID UNI2494

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 53746812..53747156 337
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000708 (Kat2b) NM_020005 K(lysine) acetyltransferase 2B Gene [Source:MGI Symbol;Acc:MGI:1343094]

 
Come back to gene ENSMUSG00000000708


For any suggestions or comments, please send an email to unitrap@crg.es