Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14563B3
Clone ID IST14563B3
Vector VICTR74
Project tigm

Sequence tag IST14563B3BBF3
Sequence
TTCCTAAGTTCCTTGGAGTCCCGGGACCAAAATGGCGACCGCTGCTGCTGTGGCTTAGGTCGCCTCCCCAGCCGGGCGGG
CACCTGTCCTCTGGTCCGGAAGGTGGCCGGCTGTCCCCGGCCCACACAGGGTGCTGCCTCANCGCCTCTGTGCTTCTGCC
TGTTCCANAANCTGTCANGTTCTCTGGCNCANCNTCTCANNTGTTCANACTAATTTCCTAANTTCNGCGGGTCCCNNANN
ANNATGGTNANNGCTNCTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14563B3HMF2
Sequence
TTCCTAAGTTCCTTGGAGTCCCGGGACNAAAATGGCGACCGCTGCTGCTGTGGCTTAGGTCGCCTCCCCAGCCGGGCGGG
CACCTGTCCTCTGGTCCGGAAGGTGGCCGGCTGTCCCCGGCCCACACAGGGTGCTGCCTCAGCGCCTCTGTGCTTCTGCC
TGTTCCAGAAGCTGTCAGGTTCTCTGGCGCACCCTCTCACCTGTTCAGACTAATTTCCTAAGTTCGGCGGGTCCCGGACC
AAGATGGCGACCGCTGCTGCTGTGGCTTAGGCCNCCTCCCCANCCNGGTGGGCACCTGTCCTCTGGTCCNGANNGTGN
Sequence Type genomic DNA
Unitrap ID UNI31344

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 27523716..27524032 303
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021879 (Dnahc7l) dynein, axonemal, heavy chain 7-like Gene [Source:MGI Symbol;Acc:MGI:2685130]


Sequence tag IST14563B3HMR1
Sequence
GGAATTTAGTCTGCTTAGGTGAGAGTCTGTACCACCTGGGAACTGCCAAAGCAACACAGTGTCTGAGAAAGGTCCTGTTT
TGGGCCTTCTTCTTCNGCCANGAGGAGGTCCAAATACAANATATCTGCGCACCTTCCCTGTAAGAGAGCTTGCCAGCAGA
GAGTGCTCTGANCACTGAAACTCANAGGAGAGAATCTGTCTCCCAGGTCTGCTGATANACGGTAACAGAATCACCAGAAG
AACANTCTCTAAACNNANTCC
Sequence Type genomic DNA
Unitrap ID UNI14866

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 4551109..4551362 240
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 9747209..9747462 240
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 13279777..13280030 240
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 9634030..9634283 240
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 3110175..3110428 240
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 3288340..3288593 240
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079407 (AC186757.2) Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q9D9B9]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 3871185..3871438 240
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 11860601..11860854 240
 
EST/CDNA Est Name
  CA980231.1 - BY014546.1 - BY281921.1 - BY072484.1 - BY013087.1 - BY028740.1 - BY028117.1 - BY025473.1 - BY147827.1 - BY028820.1 - BY793765.1 - BB843709.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 40933146..40933399 240
 
EST/CDNA Est Name
  BY108553.1 - BY111967.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 3031739..3031992 240
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 12577794..12578047 240
 
EST/CDNA Est Name
  AA168445.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 6761733..6761986 240
 
EST/CDNA Est Name
  BY300322.1 - BY785407.1 - BY780300.1 - BY792977.1 - BY145030.1 - BY794939.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 7217993..7218246 240
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 14982280..14982533 240
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 4601722..4601975 240
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 4232561..4232814 240
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 14673836..14674089 240
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 6638239..6638492 240
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 4183040..4183293 240
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166307: 48077..48330 240
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166309: 114548..114801 240
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 19228821..19229074 240
NO GENE  

 
Come back to gene BY300322.1 - BY785407.1 - BY780300.1 - BY792977.1 - BY145030.1 - BY794939.1


For any suggestions or comments, please send an email to unitrap@crg.es