Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13114H4
Clone ID IST13114H4
Vector VICTR76
Project tigm

Sequence tag IST13114H4HMF1
Sequence
TTACTAAGAACTTAGATATGAACTATGAGGGGA
Sequence Type genomic DNA
Unitrap ID UNI34865

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 108006341..108006373 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035864 (Syt1) NM_009306 synaptotagmin I Gene [Source:MGI (curated);Acc:Syt1-001]


Sequence tag IST13114H4BBF1
Sequence
TTACTAAGAACTTAGATATGAACTATGAGGGGAAAAAAAAAACAAAAANCCN
Sequence Type genomic DNA
Unitrap ID UNI34865

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 108006323..108006373 49
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035864 (Syt1) NM_009306 synaptotagmin I Gene [Source:MGI (curated);Acc:Syt1-001]

 
Come back to gene ENSMUSG00000035864


For any suggestions or comments, please send an email to unitrap@crg.es