Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14214D5
Clone ID IST14214D5
Vector VICTR74
Project tigm

Sequence tag IST14214D5HMF1
Sequence
GTACAACNAANACCCCTTTCCCCATCCTGCCTTCTGCCTNACTAGGCACATGGACNANACCGTCACCCTCCCTTTAATGT
CCATCCCATGTCTCCTTCANAGGATGCTTGGACCTGAAGTTGGAGGANCTGAAATCCTTTGTTCTGCCNTCCTGGATGGT
TGAGAAGATGCGGAAATACATGGAGACACTGCGGACAGAAAATGAGCACCGCGCTGCGGANGCGCCTCCCCAGACCTGAG
CCGGGTGTCCTGGCTACTACACTTGGCGGCCTGCCTCCAANANCCTCTTTCCCCACCCGGCTGANGCCATCATGGGGATT
TGGTCTANTTC
Sequence Type genomic DNA
Unitrap ID UNI35695

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 164593263..164593592 304
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017299 (Dnttip1) NM_133763 deoxynucleotidyltransferase, terminal, interacting protein 1 Gene [Source:MGI (curated);Acc:Dnttip1-001]


Sequence tag IST14214D5BBF1
Sequence
NTNCNNNNAANACCCCTTTCCCCATCCTGCCTTCTGCCTCACTAGGCACATGGNCNANACCGTCACCCTCCCTTTAATGT
CCNTCCNNTGTCTCCTTCNAAGGATGCTTGGACCTGANNTTGGNGGAGCTGAANTCCTTTGTTCNNCCATCCNGGATGGT
TGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000017299


For any suggestions or comments, please send an email to unitrap@crg.es