Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14723E8
Clone ID IST14723E8
Vector VICTR76
Project tigm

Sequence tag IST14723E8HMF1
Sequence
AAGATACCCTACACATCAACAAGCAGTTCATGTTTCCACAGTGAGGCTAAAGAATCAATTCATTCCTGGTAGTATTAACA
ATAAGCCCTAAGTCCCAGAAGAAATTTTCATTTTTCAATCTTCGGGTCATACTGTCTGGCATAAAAATGAAGAAAGCCAA
GATTCATAAGCCCGAATAAAGTCATTTGATCCTGCCCTATAGTTAGGCTCCATTCTCAGCATCCTTTAAACAAGGCTTGG
GTTACTGCTCCCCCAAATCTGTAACACTCTCTTCTTAGCTCTGAGCAAAGGGCCACAAAAGCTCTTTTTCACCATCCCAG
CTCAGAGCACTTTTCTACCCACCTTCAGAAAAATGGGCATAGGGGCTGGAGAGATGGCTCAGTGGTTAANANCACTGACT
GCTCTTCTGAANTCCTGAGTTCAATTCCNAGCNACCACNTGGTGGCTCACANNCNTCTCTAANGGGATGCCCTCTTCTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 107758694..107759173 456
NO GENE  


Sequence tag IST14723E8BBF1
Sequence
AAGATACCCTACACATCAACAAGCAGTTCATGTTTCCACAGTGAGGCTAAAGAATCAATTCATTCCTGGTAGTATTAACA
ATAAGCCCTAAGTCCCAGAAGAAATTTTCATTTTTCAATCTTCGGGTCATACTGTCTGGCATAAAAATGAAGAAAGCCAA
GATTCATAAGCCCGAATAAAGTCATTTGATCCTGCCCTATAGTTAGGCTCCATTCTCAGCATCCTTTAAACAAGGCTTGG
GTTACTGCTCCCCCAAATCTGTAACACTCTCTTCTTAGCTCTGAGCAAAGGGCCACAAAAGCTCTTTTTCACCATCCCAG
CTCAGAGCACTTTTCTACCCACCTTCAGAAAAATGGGCATAGGGGCTGGAGAGATGGCTCAGTGGTTAAGAGCACTGACT
GCTCTTCTGAAGGTCCTGANTTCANTTCCCAGCNACCNCATGGTGGCTCACANCCATCTCTAATGGGNTGCCCTCNTCTG
GTGTGTCTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 107758685..107759173 475
NO GENE  


Sequence tag IST14723E8HMR1
Sequence
TCTTAATTGGCATTGGCATTGGCATGCAGTTTGCCAGCACCTGTTCAGTCCAGGATGTTTTTAATACACTCTGTTTCAAA
CGCCTGCACTGCACAGGTTAGTCATGTGACAGACTCATGCCTCAGAGTCATGGGGTTAAATGGAACACCAGTACTGTTTT
CCTGCTTAGGTTATGAAGTANTCCTTCCAAATGCTGACATGCTTGTAGCTCCTGTCATCTAATCANAANTGANCTACTGA
NAAGAAAAAATAGGACATGGAGAGGATTTTCTTGGAGGAGTTCCTTCTGGGAGGTCNTTGN
Sequence Type genomic DNA
Unitrap ID UNI15801

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 107759170..107759469 288
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031889 (D230025D16Rik) NM_145604 RIKEN cDNA D230025D16 gene Gene [Source:MGI Symbol;Acc:MGI:2443049]

 
Come back to gene ENSMUSG00000031889


For any suggestions or comments, please send an email to unitrap@crg.es