Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12950B9
Clone ID IST12950B9
Vector VICTR76
Project tigm

Sequence tag IST12950B9HMF2
Sequence
AAATCNTGTCTGTTACTTACATTATTTAAACNNGTGTCCCTGTCAGGATGAANAAGGCATGCTTTCCAGCCTCACCAATG
CGCTGAAAGTCCTTGCACGGAAGCTATTGTGATGCTGTGCTCTCCCAGCGCCCGCCCTACCTTCTCAAGGCCTTGGTTTC
TATGGATGAAAAGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 31886301..31886473 163
NO GENE  


Sequence tag IST12950B9BBF1
Sequence
CTGGCAATCTCTGGAGTTAGTTGTTATAGTTGTCTTTGTTAAGAGATTGTTCCTCTGTTGATTTTGTTACCCTCTATCAG
CAGGCGTGGGAGACAAGCTCTCTTCTCTGAGTTTCAGTGGTCANAGCANTCTCTGTAGGCAAGCTCTCCTCTTTCAGGGA
AGGTGTACAGTTATCTGGTGTTTGGACCTCCTCCTGGCTGAAGGTGANNGCCCAAAACAGGATCTTTCCCANAANCTGTG
TTGCTTTGGCCNNGANNGTGNCN
Sequence Type genomic DNA
Unitrap ID UNI35327

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 21133151..21133410 240
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 30136630..30136889 240
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 37433619..37433878 240
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 59899521..59899780 240
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 11154849..11155108 240
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 25127251..25127510 240
 
EST/CDNA Est Name
  CA585334.1 - AA178048.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 89383717..89383976 240
 
EST/CDNA Est Name
  BG229216.1 - AI481386.1 - AA445850.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 29231612..29231871 240
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 3174583..3174842 240
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 37246625..37246884 240
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6724510..6724769 240
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 7900910..7901169 240
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 23016128..23016387 240
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 13816766..13817025 240
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 28839660..28839919 240
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 12329298..12329557 240
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 26666594..26666853 240
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039335 (Spata16) NM_027583 spermatogenesis associated 16 Gene [Source:MGI (curated);Acc:Spata16-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 9985906..9986165 240
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 7507986..7508245 240
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 79122496..79122755 240
NO GENE  

 
Come back to gene ENSMUSG00000039335


For any suggestions or comments, please send an email to unitrap@crg.es