Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12772E12
Clone ID IST12772E12
Vector VICTR76
Project tigm

Sequence tag IST12772E12BBF1
Sequence
TTGTTTGCCCACATGAACATACATACATACATGCATACCACACACACACACACACACACACACACACACACACACACACA
CACACAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 26794983..26795067 83
NO GENE  


Sequence tag IST12772E12HMF1
Sequence
NTGACAGGAAGGTGCAACAAAAATAATATTATGATGGGGGGGGGGGT
Sequence Type genomic DNA
Unitrap ID UNI15985

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66511962..66512006 45
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019873 (Reep3) NM_178606 receptor accessory protein 3 Gene [Source:MGI Symbol;Acc:MGI:88930]

 
Come back to gene ENSMUSG00000019873


For any suggestions or comments, please send an email to unitrap@crg.es