Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14198H9
Clone ID IST14198H9
Vector VICTR74
Project tigm

Sequence tag IST14198H9BBF1
Sequence
CCTTGACGCCCACCTTCCCCTCTCTTCAGACTTTTCACTCTGCATCGCACATTGCTCCAGAGCCCTCCCTGCAGGTTTTG
CCTTCCCTCCTTCCCAGCGAACCCCGCCCCCTTCACATGCGATCTTATCACCTGTGATCCTTGCCAGTCCTTGGCCGTCT
AGCGTGTGGCTCTCACCTGGCTTAGTGACAGGCTCAGAACTTCCCTGTAGAGCTAGAGGCTACTGTCTGCACTGTCTGAA
CTTCTTTCTTCCTACCCCTGACAACCNGCTCGGGGACCTCTTCTCCAGCTCATCTCACCATCTGCGGGACTTTCCATAGT
GGACTGAAAGTTTGCTAGTTTTTTATTCCATGGCCGACCTGGTCCTCTCACACACTTTCCCCTGGGCTGTGGCTGTCTCG
TATTCTACACATGGATAGCGCTGTCTTTTCTCTGTGCANAACTN
Sequence Type genomic DNA
Unitrap ID UNI26463

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 40000367..40000809 439
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025602 (Zfp202) NM_030713 zinc finger protein 202 Gene [Source:MGI Symbol;Acc:MGI:1933401]


Sequence tag IST14198H9HMF1
Sequence
CTTGACGCCCACCTTCCCCTCTCTTCAGACTTTTCACTCTGCATCGCACATTGCTCCAGAGCCCTCCCTGCAGGTTTTGC
CTTCCCTCCTTCCCAGCGAACCCCGCCCCCTTCACATGCGATCTTATCACCTGTGATCCTTGCCAGTCCTTGGCCGTCTA
GCGTGTGGCTCTCACCTGGCTTAGTGACAGGCTCAGAACTTCCCTGTAGAGCTAGAGGCTACTGTCTGCACTGTCTGAAC
TTCTTTCTTCCTACCCCTGACAACCAGCTCGGGGACCTCTTCTCCAGCTCATCTCACCATCTGCGGGACTTTCCATAGTG
GACTGAAAGTTTGCTAGTTTTTTATTCCATGGCCGACCTGGTCCTCTCACACACTTTCCCCTGGGCTGTGGCTGTCTCGT
ATTCTACACATGGATAGCGCTGTCTTTTCTCTGTGCANAACTCCCCANAGGGAGATCTCTANGTCCNNCTTANCNTCTTG
NTCNTGGTTNNNANTGCCNCATCTANGGG
Sequence Type genomic DNA
Unitrap ID UNI26463

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 40000368..40000875 478
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025602 (Zfp202) NM_030713 zinc finger protein 202 Gene [Source:MGI Symbol;Acc:MGI:1933401]

 
Come back to gene ENSMUSG00000025602


For any suggestions or comments, please send an email to unitrap@crg.es