Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10804G5
Clone ID IST10804G5
Vector VICTR76
Project tigm

Sequence tag IST10804G5HMF1
Sequence
CTTCCAAATACTGACACCATTGCATACACTAGCAAGATTTCGCTGAAAGGAA
Sequence Type genomic DNA
Unitrap ID UNI35701

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 14190925..14190975 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 62233355..62233405 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 14890676..14890726 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 99859856..99859906 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 13032056..13032106 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 101488443..101488493 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 13340750..13340800 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 44004059..44004109 51
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061535 (C1qtnf7) NM_175425 C1q and tumor necrosis factor related protein 7 Gene [Source:MGI (curated);Acc:C1qtnf7-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 35851717..35851767 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 9008037..9008087 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 128631247..128631297 51
NO GENE  


Sequence tag IST10804G5BBF1
Sequence
CTTCCAAATACTGACACCATTGCATACACTAGCAAGATTTCGCTGAAAGGACCCAGTTATAGCTCTCTCTTGTGAGACTA
TGCCGGGGCCTAGAGGTTTTTCTCTTAGGTGTTTCTAGATCCTGTCAGACTGACGATCAGAATCTCTCATCACAAGCACA
AACATTTTCCATAACAAGACTCGCAAATGGATGTCGGGTGTATGAAAGAGAGCAACAGCTCTGATCTTCTCGGAAGTTAA
GATTACCCATAATAACACAGCGCTTCATCCCTGGGAAAATGGTANTTACCANNNGATGGAGGAGAGGGAGAAAGGAGAAC
ACTTGGCTATTTTTGGTCGGAATGGTAATTAGCAAACCTGCTATGGAAGTCAGTATGGGGATTTCTTTAATAAACTAAAG
TAGANCTATCTTATGATCCAGTAATCTCACTTCTCGGTGTGTTTCAAAAGGCACTGAAGTAAGTATGGATAGGGTGTANC
GAACAGACACNACACAATGCTACTCACTCTTTAAAAATAAGANAACCCTATCATTTGTGTGCTCTTNNNCNAGCTNANAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 99859856..99860410 531
NO GENE  

 
Come back to gene ENSMUSG00000061535


For any suggestions or comments, please send an email to unitrap@crg.es