Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15002F4
Clone ID IST15002F4
Vector VICTR78
Project tigm

Sequence tag IST15002F4HMR1
Sequence
ATGTGGGGAGGGCACTTAGGGTGATCCCAGTCACAGAGGTGGGGGTTGGGAGGACTCCTACTTCCNCTGCCCCCTCTCAC
CTCACCAGACGCCGGGAGTCCCCTGCTTCCCTGTCCTTTGGGTTGATGATGAGTGGGTGTCTCTGCGTGTGCNCAGGGCT
GTGGGGGCGCCCCTGGTCTAGGTCATGCCTTCTGCCCTTTTCCTTGGCTCGCCTTGGCTGANGTGTCCCTGTANTGGCGA
AAGTCNCNNTACNGTGGCTANGTGGCTTTCNTCCATAATTCNCTGGGTTN
Sequence Type genomic DNA
Unitrap ID UNI16469

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 30994618..30994906 267
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027660 (Skil) NM_011386 SKI-like Gene [Source:MGI (curated);Acc:Skil-001]

 
Come back to gene ENSMUSG00000027660


For any suggestions or comments, please send an email to unitrap@crg.es