Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15073B2
Clone ID IST15073B2
Vector VICTR80
Project tigm

Sequence tag IST15073B2HMF2
Sequence
CTGTTTAAAACAAAATCATTTCTTTTAGCAATGCTAATCCAACTTGATGTTGTCTTTGGCGAATAGTCTCACAATTCACC
TGTCTGTGCCTGAATATACTTATTTGTACTGACTGTCTTGAGGGTACTCCATCAAAAATCAATACTATAAGGAGTGTCTA
TTATAGCCAGGAGTTAAGAAATGCAGAACAGTACAAAGCATAACGTCTGTATGGGTGAGAGCAGAAGTATACTCCAAACA
AGTTTTGTGAGGCATTTTCTCATTTACAAAGCAAAATTAAAACAAATCACGTACGCCTGAATTTCGTCTTGACCATAATC
CCGTATTCCCGTTTTACAGATGAAAAACCCTGANACTTCATTTTCCACTCTTTTATTGCTACAAAAAGGACAATTNTACN
CACAGAGAGAAAGAACANGTCTGTACAGAACAAANTACCCAAANGNCTGCNANANTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 8423171..8423620 436
 
EST/CDNA Est Name
  BF018811.1


Sequence tag IST15073B2HMR1
Sequence
NGGGAGGTACTGGGCATTGTTTGGATAATGTTTATCTCAGATGCTATGTTTTAAAATTAAATCTCAGCGCCAAGTATGAG
ATGTCTCTGCCTATGACTTTT
Sequence Type genomic DNA
Unitrap ID UNI31033

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 44901861..44901960 100
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071856 (Mcc) NP_001078843 mutated in colorectal cancers Gene [Source:MGI Symbol;Acc:MGI:96930]


Sequence tag IST15073B2BBF1
Sequence
CTGTTTAAAACAAAATCATTTCTTTTAGCAATGCTAATCCAACTTGATGTTGTCTTTGGCGAATAGTCTCACAATTCACC
TGTCTGTGCCTGAATATACTTATTTGTACTGACTGTCTTGAGGGTACTCCATCAAAAATCAATACTATAAGGAGTGTCTA
TTATAGCCAGGAGTTAAGAAATGCAGAACAGTACAAAGCATAACGTCTGTATGGGTGAGAGCANAAGTATACTCCAAACA
AGTTTTGTGAGGCATTTTCTCATTTACAAAGCAAAATTAAAACAAATCACGTACGCCTGAATTTCGTCTTGACNATAATC
CCGTATTCCCGTTTTACAGATGAAAAACCCTGAGACTTCNTTTTCCACTCTTTTATTGCTACAAAAAGGACAATTNTNCN
CACNGAGAGAAAGAACNNGTCTGTACAGAACAAAGTACCCAAANNGCTGCNANAGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 8423165..8423620 430
 
EST/CDNA Est Name
  BF018811.1

 
Come back to gene BF018811.1


For any suggestions or comments, please send an email to unitrap@crg.es