Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14262F9
Clone ID IST14262F9
Vector VICTR74
Project tigm

Sequence tag IST14262F9HMR1
Sequence
GGTCAAAACTATATCAGCAAGTTAGCCTTGAATGCACAAAATTTACTGAAAATCTCTTCATATACAGTTTATGCTTTTGT
CCCAGGAGTGTTTTTGCATGTGTATGTATGGGAACTGTTC
Sequence Type genomic DNA
Unitrap ID UNI25340

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 105063536..105063654 119
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020694 (Tlk2) NP_036033 tousled-like kinase 2 (Arabidopsis) Gene [Source:MGI (curated);Acc:Tlk2-001]


Sequence tag IST14262F9HMF2
Sequence
NNTTGNNNNTTTTAANANNTNANAAATTCCTTANTTTACTCAAACTCANAACAGCTGATTCTTTGAAAAAATCAACAAGA
TAGATAAACCCTTANTGAGACTAACAAGACACCACAGAGACAGTAACCAAATTAACAAAATCANAAACGAAAAGGGAGAC
ATAACAACAGAAACCAAAGAAATCCAAAAAAATCATTCTACTATAAAATCCTATAGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14262F9BBF1
Sequence
ACTTGCCAGTTTTAATAACTCAGAAATTCCTTAGTTTACTCAAACTCAGAACAGCTGATTCTTTGAAAAAATCAACAAGA
TAGATAAACCCTTAGTGAGACTAACA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 145384311..145384416 106
NO GENE  

 
Come back to gene ENSMUSG00000020694


For any suggestions or comments, please send an email to unitrap@crg.es