Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14528H7
Clone ID IST14528H7
Vector VICTR74
Project tigm

Sequence tag IST14528H7BBF1
Sequence
AAATAAAGCCATTTAATCACCAACAGATCCTGATCTTAAGGGTTCTCCCTATACTGGGCATTATATATATAGGTAAATTA
TCCGTCTGCATCTTATACTTCTCACGCAGCCACCTTAATTACAATCACAAAAGCCTCTCGTTGGCTCTCGGAACCACGCT
AAGAGGTGGCGCAGCAGGTGACCGAGGTGACCCACACAGCCGCTCCAAGCTGGGGTCCGGCAGCTCACAAAGTCTCCCCG
GGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 77334183..77334425 243
 
EST/CDNA Est Name
  AA125059.1


Sequence tag IST14528H7HMF1
Sequence
AAATAAANCCNTTTAATCACCAACANATCCNGATCTTAAGGGTTCTCCCNANACTGGGCANTATANATNNAGGTAAATTA
NNCNNCTGCATCTTATACTTCTNANGCANCCNCCTTAATTACNANCNCANAANCCTCTCGTTGGCTCTCGGAACCACGCT
AAGANGTGGCNCANCAGGTGACCNANGTNACCCACACANCCNCTCCAANCTGGGGTCCNGCAGCTCACANANTCTCCCCG
GGTCNCCNNCGCTCTCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14528H7HMR1
Sequence
TTTACAGTTGTACATTACCGAGCTGCTAATCTTAAGGCTATAACC
Sequence Type genomic DNA
Unitrap ID UNI14545

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 77334142..77334185 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055923 (Aasdh) NM_173765 aminoadipate-semialdehyde dehydrogenase Gene [Source:MGI Symbol;Acc:MGI:2442517]

 
Come back to gene ENSMUSG00000055923


For any suggestions or comments, please send an email to unitrap@crg.es