Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11585A2
Clone ID IST11585A2
Vector VICTR76
Project tigm

Sequence tag IST11585A2HMR1
Sequence
TATTCCTAAATATAGCCTATTTAGTCTGTATAATATGTTACTTGTATGTATATTTTCAGGGCTGGCCAG
Sequence Type genomic DNA
Unitrap ID UNI22841

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 70321644..70321711 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032217 (Rnf111) NM_033604 ring finger 111 Gene [Source:MGI Symbol;Acc:MGI:1934919]

 
Come back to gene ENSMUSG00000032217


For any suggestions or comments, please send an email to unitrap@crg.es