Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15052E9
Clone ID IST15052E9
Vector VICTR80
Project tigm

Sequence tag IST15052E9HMR1
Sequence
NNAGTNNTGAATCTTAATGGTCCTTCTTATCAAAAGGTTATGANAACTTGGTGANGCNGTATGACTTTCTTATTAACAGC
TCCAAAATGGATCAAAATGTTCGTTTTGGACGAAGCAGATGAAATGTTGAGCCGAGGGTTTAAGGATCANATCTATGANA
TTTTCCNNAAATTAAATACAAGCATTCNGGTAAAGTTTATTTCTTCTATTTATTTGGGGTTAGGTTTCATGCAGGTACAG
TTACAATAAAACTGAAGTGTTCTATTGTCGTTCCCCCTGCTTAAAGCATTTGATACATTACTATCTCTGCCTAGCTCTAC
CATACTAAGGCAGAGACGCTTGGTTTCAAACATTTTCCCGTCTAGCATTTGCTAAAAAGATTATACAAACTAAACAGATA
AAGACAAGCATTTTATTTTTTAAAGGTTGTGTTGCTTTCTGCCACAATGCCNACTGATGTGCTAGAAGTGACCAAGAN
Sequence Type genomic DNA
Unitrap ID UNI23223

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 23110230..23110704 453
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022884 (Eif4a2) NM_013506 eukaryotic translation initiation factor 4B Gene [Source:MGI (curated);Acc:Eif4a2-002]

 
Come back to gene ENSMUSG00000022884


For any suggestions or comments, please send an email to unitrap@crg.es