Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10814C11
Clone ID IST10814C11
Vector VICTR76
Project tigm

Sequence tag IST10814C11HMF1
Sequence
TTTTGCACATAATACCTACTCCCAAGCAACCCCATTCTACTGAGTTCTCATAAAAATGACTGAATTGCCATAGATCCCAG
CAGTCTTCTCAGTATAGTTTCCATGCACTTGAAATTAGTTTAAAGAAGAACCAGAATTCTCATGTTCATTACAGTTGTAT
TATGGTAGCCTAAT

Sequence Type genomic DNA
Unitrap ID UNI4672

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166313: 16258..16429 160
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 98298619..98298790 160
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074887 (A630089N07Rik) RIKEN cDNA A630089N07 gene Gene [Source:MGI Symbol;Acc:MGI:2444323]

 
Come back to gene ENSMUSG00000074887


For any suggestions or comments, please send an email to unitrap@crg.es