Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST464697
Clone ID OST464697
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST464697
Sequence
ATTGAGGTGACTGTGCCCAGGTATGCGGCTGCAACGAGGAAGGGCATGCTGGAGAGGCTGCCTCGCTGTGGGAAAGCCTT
CGCTGACATGATGCAGAAGGTGGCTGTCTGGAAGTGGTGCAACCTGTCGGAGTTCATCGTGTATTATGAAAGCTTCACTA
ACGTGCACCGAGATGGAGACCAACATCATGGGCTGCTACTGGCCCAACCCGCTGGCCCAGAGCTTCATCACTGGAATCCA
CAGGCAGTTCTTTTCCAACTGCACGGNGGACAGGACCCACTGGGAAGACCCCCCGGATGAAGTACTCATCCCACTGATCG
CGGTTCCTGTCGNGCTGACTGTGGCTATGGCTGGCCTGGTGGTGTGGCGCANCANGCACACTGATCGGCTGCTGTGAGGA
TCTGCTGGATGGAGGGCCATGCCTGGCAGGCTGGGAGAATGTTGCTCANAGCTCTGAGAGCTGGCAGACTCNGCTTCTGT
CTGGTTTGCTTTGGCCACACCCTACCTGGCCATGCCAAAGTCCTCCTGACCAGGCTGGTGTGG
Sequence Type mRNA
Unitrap ID UNI16235

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 6574764..6576887 387
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041046 (Ramp3) NM_019511 receptor (calcitonin) activity modifying protein 3 Gene [Source:MGI (curated);Acc:Ramp3-001]

 
Come back to gene ENSMUSG00000041046


For any suggestions or comments, please send an email to unitrap@crg.es