Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14806C2
Clone ID IST14806C2
Vector VICTR76
Project tigm

Sequence tag IST14806C2HMR1
Sequence
CTAACTAACTAACNAACTAACTCTCTCTCTCTTTNACACACACGCATACACACACACTTACATGCTTTCTCCCTGTCTCT
GCTACCTCTGTCTCTGTCTCTCTCTCTCACTCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 26408160..26408272 109
NO GENE  


Sequence tag IST14806C2BBF1
Sequence
GTTAGTTAGTTAGTTAGTTAGTTTTAGAGTTGTCAGGTACAGAAGCTGCCCTTGAGTACACTAGGCACAGAAAATAAGCA
CTGTCCCAAAATATTGACTTACAAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI25435

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 26408268..26408376 109
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007817 (Zmiz1) NM_183208 zinc finger, MIZ-type containing 1 Gene [Source:MGI Symbol;Acc:MGI:3040693]

 
Come back to gene ENSMUSG00000007817


For any suggestions or comments, please send an email to unitrap@crg.es