Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10890H9
Clone ID IST10890H9
Vector VICTR76
Project tigm

Sequence tag IST10890H9BBF1
Sequence
NACCAAGACATATAAAACATATTTATACTTTTGAAACTATTTANAAACAAAAATGAAATGGCCATATACATTTGCTCATT
TAAACCAAACAAAATTCTTAATTTTTCTAGCTGTAATTTCAAAAGAGGANCACCTTGTNNCCTGATGAATCCAATTTTTG
TAGGAAAAACAGCCATCTGTTCCCTTACCATANAACTTTGANAAGCTGNNGGTCCNNATNANAACAGCATTTATAATCNN
TGNCNNNNNNGGCTTCTNTANCCNCACTAGATTCCTAACTACNGGTGCANGGTTCTAAAGACCANNTNNTACTGTTTATT
TTATTTTATTTNATTNTNNTN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10890H9HMR1
Sequence
GGTTATAGATTANGGCTCATAAGTTATTGGTTATGATTAAAAATTTGTAACATTGGTAACAAAAAGT
Sequence Type genomic DNA
Unitrap ID UNI2143 UNI30968

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166451: 3892..3959 62
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 22800901..22800968 62
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 17231494..17231561 62
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 6578900..6578967 62
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 18013231..18013298 62
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 22633267..22633334 62
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 62657242..62657309 62
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074865 (6720457D02Rik) RIKEN cDNA 6720457D02 gene Gene [Source:MGI Symbol;Acc:MGI:1924367]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 13567338..13567405 62
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 5064453..5064520 62
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 105621434..105621501 62
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 51320866..51320933 62
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 22874684..22874751 62
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 66564818..66564885 62
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039005 (Tlr4) NM_021297 toll-like receptor 4 Gene [Source:MGI (curated);Acc:Tlr4-004]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 21607999..21608066 62
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 114434215..114434282 62
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 150531200..150531267 62
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 92523412..92523479 62
NO GENE  


Sequence tag IST10890H9HMF2
Sequence
AACCNAGACATATAAAACATATTTATACTTTTGAAACTATTTAGAAACAAAAATGAAATGGA

Sequence Type genomic DNA
Unitrap ID UNI35549

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 92523476..92523536 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 74181346..74181406 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 13567402..13567462 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 62657306..62657366 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 22633331..22633391 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 18013174..18013234 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 6578964..6579024 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 9594051..9594111 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 22800965..22801025 59
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052387 (Trpm3) NM_001035244 transient receptor potential cation channel, subfamily M, member 3 Gene [Source:MGI Symbol;Acc:MGI:2443101]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 150531264..150531324 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 21607942..21608002 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 66564761..66564821 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 27793216..27793276 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166342: 191299..191359 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 26742552..26742612 59
NO GENE  

 
Come back to gene ENSMUSG00000052387


For any suggestions or comments, please send an email to unitrap@crg.es