Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12094E9
Clone ID IST12094E9
Vector VICTR76
Project tigm

Sequence tag IST12094E9BBF1
Sequence
GCCTCGGAAATACCACATACTTTGAGACAGGCTCTCTCATTGCCTGGAGCTCACCAATGAATCTAAGATGGCCAGCGAGT
GAGACGCCCGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 168625472..168625565 94
NO GENE  


Sequence tag IST12094E9HMF2
Sequence
TAACACCAAGTGATAGCAACAATAATTCTTTACTGACTACGCAGCTGCTAATGTCAGTAAGAATGATTTTTTTTTTTTNN
CN
Sequence Type genomic DNA
Unitrap ID UNI15375

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 90915753..90915830 78
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035246 (Pcyt1b) NM_211138 phosphate cytidylyltransferase 1, choline, beta isoform Gene [Source:MGI (curated);Acc:Pcyt1b-003]

 
Come back to gene ENSMUSG00000035246


For any suggestions or comments, please send an email to unitrap@crg.es