Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XP0416
Clone ID XP0416
Vector pGT0lxf
Project sanger

Sequence tag XP0416
Sequence
AGTTAGTAGCAAAGAACGCTAGCATCTTGTATTGCCATTCAGATGGGAGGGGGAATGAAGACAGAGACAAGAATTCGGAA
GCCGGGGCATCTCCTCTTTAGCCTCACATATAACCCCGCTCCCTCCAATACTTTGCCCTTTACCACCTGCTTCACACGCC
TAGCTCCATCCCTACCCACCTGGTTTCCCGGGCAATAGCTTCTCGCCAGATCCCTATAACCGACCCCCCCCCGCTAGCCT
GCATGCCCCTCGTCACATCCAGCTCCCTGCACCCACCCCCGCGCCTCCCACCAAAGCGAGCACGGCGCGGAGGAGCCTGG
CCGGCCCATGGCGCTGTGTGCGCTGACGAGTGCTCTGCGCTCTTTGAGCCTGGCATCCGCGGCCATTACCGCCCGGGTTC
CGACTCTGCTCCCTGCTGCCCAG
Sequence Type mRNA
Unitrap ID UNI3031

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 46783217..46783347 129
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002767 (Mrpl2) NM_025302 mitochondrial ribosomal protein L2 Gene [Source:MGI (curated);Acc:Mrpl2-001]

 
Come back to gene ENSMUSG00000002767


For any suggestions or comments, please send an email to unitrap@crg.es