Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14438F10
Clone ID IST14438F10
Vector VICTR74
Project tigm

Sequence tag IST14438F10HMR1
Sequence
NTGGTGTGGTACCCTGATGTTAATTTTCTTAACTTCNATTCTACAACTTATGAGCCCTATCTTCAGATAGATCAATTGAC
TCTTCCTGCTGTGGAATTGCTTAGAACTTCTGTAGCATATCTGGGGTCCCTTGATGCACCCATCAAGGGAAAAGCAGCCC
AGGGGTTTGAGCTATCTCAAGCTGTTTANAAAGCTCCTGCCTGGGAATTGTGTGCCGTTTGANGCCTGAANCTTGCTGGA
TCTTTTGNCN
Sequence Type genomic DNA
Unitrap ID UNI29823

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109418671..109418917 235
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041438 (Cirh1a) NP_035704 cirrhosis, autosomal recessive 1A (human) Gene [Source:MGI Symbol;Acc:MGI:1096573]

 
Come back to gene ENSMUSG00000041438


For any suggestions or comments, please send an email to unitrap@crg.es