Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10880F9
Clone ID IST10880F9
Vector VICTR76
Project tigm

Sequence tag IST10880F9HMR1
Sequence
ANATCANAANAAGGCATTGGATCTCCTGAAAGTANACTTACAAATTGTTGTGAGGCTCAATACGGATGCTGGGATTTGAA
CCATTGTAAGAGTTGCAAGAGCTCCTAACCACTGAACCAACTTTTAGGCTGTTTTTAACCCATGATTTGAGGCCATTTAN
GAACTTTTTTTTTTTTTTTTTTTA
Sequence Type genomic DNA
Unitrap ID UNI530

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 104444579..104444759 173
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027176 (Cstf3) NM_145529 cleavage stimulation factor, 3' pre-RNA, subunit 3 Gene [Source:MGI (curated);Acc:Cstf3-001]

 
Come back to gene ENSMUSG00000027176


For any suggestions or comments, please send an email to unitrap@crg.es