Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11547E9
Clone ID IST11547E9
Vector VICTR76
Project tigm

Sequence tag IST11547E9HMR1
Sequence
TTCACTCCACCATCCTGAAGCTAGGATGTGCACACAAGAGGAGCCTTGGTTCTCTGCAGTGCTGTCTGTTTCTCAAAGTC
CTCGGTAACTCCCAGGACCCCAGCTGTGGGAAGAGCTTCAGCAGCTGTGGATCANCTGCTTGAGTGTGCCCTCTGCNCCT
GCCCTCCACCTGCCCTCTGAGAGCTCANCTCTTACTTCCCAAAGGCCCCACTTAGGCTATGCTCTANCTCCTGTTANCGA
GTCNNAACCTAACTCCNGTATANCTTGGCTCCANAGTTACACAAAACCTCATTCTTTGANAATGTATCAAGANTGACTTT
TCCAGCNCAAAANCCATATGTATATGTNGTATATGTATATGATGTATATGTGTATATGATGTANATGAGTCATATGTATA
TGATGCANATNATGTNNTNTNTGAATNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11547E9HMF1
Sequence
NCGTGAGCACCCTTTAAGTGAGGGAAGAGCCTGGGAAGGTGGCTTCTCTGANAACTGCAGCANAGTGAGTGTGGA
Sequence Type genomic DNA
Unitrap ID UNI22302

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 31559380..31559452 69
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041119 (Pde9a) NM_008804 phosphodiesterase 9A Gene [Source:MGI Symbol;Acc:MGI:1277179]

 
Come back to gene ENSMUSG00000041119


For any suggestions or comments, please send an email to unitrap@crg.es