Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15052H4
Clone ID IST15052H4
Vector VICTR80
Project tigm

Sequence tag IST15052H4HMF1
Sequence
ATTCTCCCTTGCCCTCTCTGGTCCTTCCTTTTTCCTAGGAAATGCCAAGACAACACATTCCTTCTCAGGTCAGATAAATG
TTATGAGGACAGGCAAACAGATTACTATGAATCATTTGCAAAGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 71675610..71675732 123
NO GENE  


Sequence tag IST15052H4BBF1
Sequence
ATTCTCCCTTGCCCTCTCTGGTCCTTCCTTTTTCCTAGGAAATGCCAAGACAACACATTCCTTCTCAGGTCAGATAAATG
TTATGAGGACAGGCAAACAGATTACTATGAATCATTTGCAAAGTAAACTGAGGTGCAGAAGGTAAGACCTTTAGTTGTGA
AGGTACACGTGAAAACTTTTTAAAGACTTCAAATGCACTCAAGTTTGATAAACAGCCTAGCCTGATGGCGAACACCTGTT
GCTCTAGCACTCGAAAGGCTGAGGCAGAACTTTGAGTTCGAGGTCTACCTGGCCTACAGTGCAAAACGTGTTTCAGAAAC
AGTTTGATCAACAGAAAATGTCTGCTACCTAAAGAGTTCTAGCACTAGGGGCCAAGCCCTTANGCGACAGCTGCAGTGAA
GGGAAGGGCAGATTCNATCCGACTAGCCNAAANAATCTGGGTAGCGAATAATTNNAANCTTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 71675271..71675732 448
NO GENE  


Sequence tag IST15052H4HMR1
Sequence
ATAGTTGGTGGAGAGGAAGGAAGGGAGTATAGGTGGTATAGGATCTTGTAGGCTGTTGTATGGACTTTGCTTTTTAACAC
TAGGAGAAATGGAAACTCTGAAAGAGTTCATGGTAGAGAAGAGAAGTAGTTTGAGTTATTTTTGAGGTAATTGGCCCCAG
TGGGGCCAATTAACTGCAAAGGGCCATTGAAAAGGCAAAGCATGGTGACCCGTAAAGAGATTATTGCANTANTGCAGGTG
AAAGATGATAGCGCTGTCAGCCTTGAATTACTGAAAAAATTTAAAATGTACAAAAGTAGAAATAATAATATAGTAAATTC
CATGTACACATTTCTTANCTGTGACTATCANCTCATAGTTC
Sequence Type genomic DNA
Unitrap ID UNI35719

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 71675731..71676090 352
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004221 (Ikbkg) NM_010547 inhibitor of kappaB kinase gamma Gene [Source:MGI (curated);Acc:Ikbkg-001]

 
Come back to gene ENSMUSG00000004221


For any suggestions or comments, please send an email to unitrap@crg.es