Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14983E2
Clone ID IST14983E2
Vector VICTR76
Project tigm

Sequence tag IST14983E2HMF1
Sequence
CCATTTAAATANTGTCAGGGGGCTGGAGGATGGCTCANCATTAANAGTACTTGCTTCTCTTAANAANAAATAAATANANT
TCNNANCACTCNTCTAAGGTGAGGCTCACANNTNNNNCTCCANCCCCANGGAANCCCACNCCCTCTTCTGGGCCTCTTAA
GGCCTGTNCTCCTGTGCACACGCTCATATACNGACNCATAANTAAATAAATAAATAATCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14983E2HMR1
Sequence
TTNNATGGCATAATTATGTAATTCAATAANTTGCNTCTCTGTTACTTAAAAGCTTTACTACTAAATGAATATTTGAATTC
GACCTAAAAATTAGTACATTAAAAAGGGATTGAAGTTCTGCCCTTTTGAGACAGTGTGAAGTCCATCCTGTTCAGCCCAG
CATACGGATCACTATAATCTTAGTGGCACTAACCTTACTGCNTTGGCNTCNCGGCTTATTTTGTGTTCCATCANTACTGA
GTTGTTAAAGCCCTTTAAGTTCTTCTTCANAATTATCCTCTTCTTTCTGTTC
Sequence Type genomic DNA
Unitrap ID UNI10888

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 58331179..58331465 273
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027810 (Eif2a) NM_001005509 eukaryotic translation initiation factor 2, subunit 1 alpha Gene [Source:MGI (curated);Acc:Eif2a-001]

 
Come back to gene ENSMUSG00000027810


For any suggestions or comments, please send an email to unitrap@crg.es