Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14842F4
Clone ID IST14842F4
Vector VICTR76
Project tigm

Sequence tag IST14842F4HMF2
Sequence
TTCCCAAGCAACCCGACTCCGGGAAGACCCGAGCCCGGCGCGCCGGGGGCCGCTACCGGCCTCACACCGTCCACGGGCTG
GGCCTCGATCAGAAGGACTTGGGCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14842F4HMR1
Sequence
GGGAATGCAGCCCAAAGCGGGTGGTAAACTCCATCTAAGGCTAAATACCGGCACGAGACCGATAGTCC
Sequence Type genomic DNA
Unitrap ID UNI28357

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 147072705..147072771 67
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029635 (Cdk8) NM_153599 cyclin-dependent kinase 8 Gene [Source:MGI (curated);Acc:Cdk8]


Sequence tag IST14842F4BBF1
Sequence
GTTCAATAAGTGCTTCTTAAGTCAGCTAACTTAAAAGATGCAATGGAAATTTGAACCATGACTTTTGAGGACATGCTCAA
GTGTCCTCATCACTTCATTGAGTAATGCTCTCTAAAGGAAATCACTAAGCAATTAGAGAAGAATTCTACTGAGTCCCCAA
CCCAACTGAATAATTGTAACCTGCTCTTATACTTAATAAAAGGCAGTGAGTAAAGAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 154759796..154760016 221
NO GENE  

 
Come back to gene ENSMUSG00000029635


For any suggestions or comments, please send an email to unitrap@crg.es