Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11845E2
Clone ID IST11845E2
Vector VICTR76
Project tigm

Sequence tag IST11845E2HMF1
Sequence
AGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCCGTAACAAGATCTGACACCCTCTTCTGGAGTGTCTAAAGA
CAGCTACAGCGTACTTACATATAATAAATAAATAAATCTTAAAAAAACAAACAGTGAATAGGCACATGCATACTGTGTAT
AAGCTCACCCACTCTTTCTTGTGTACACAGACAAATGCTCACAAACGGTTCACACACACACAGCAATAGCAAAACACATG
TGCACACACACAAAGACAAACAGCCNTGTAGACATATGCTGATGTACATACACACAAAGTCAAGCACACAGACTATCTGA
NGAGCAGAGAGGGAACAAACTCCGATTTCCCTCTGAAGGATGAGGGTTTGAAGTGATTTTGGTGGCCTGGGATATGTTCC
TTTCCCCTAACTTTGGGTTGGTTGTCTTANGCNAAGATAGGGAAGCTGATGGGTCCNTAGCATCCAGTGAGCATGTTTCT
GGTGTATAGGANANGCCTCGCTCCCCAAATTTTGGGTTACTAAACNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 52683168..52683692 511
NO GENE  


Sequence tag IST11845E2BBF1
Sequence
AGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCCGTAACAAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI12672

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 26417983..26418037 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 20308862..20308916 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 34849562..34849616 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 55580663..55580717 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 18030965..18031019 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026743 (Mllt10) NM_010804 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 Gene [Source:MGI (curated);Acc:Mllt10-001]

 
Come back to gene ENSMUSG00000026743


For any suggestions or comments, please send an email to unitrap@crg.es