Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14413C1
Clone ID IST14413C1
Vector VICTR74
Project tigm

Sequence tag IST14413C1HMF1
Sequence
TGCTTGAAATCCAGTTACTGAAAACACCCACAGAAGGGGGTGCCTGTTGGCTGGGTGTCCAGCTTGTANTANAGTGTTTG
TGTAGCATGCACAAGGCTCCGAGTTTGATCCCACGCACCATGATGATAATAACAATCTAAAGCACATTCTTGAATATCAC
TAGCACCTTCATTCTGAGGCAGTTGCTTAATATACGCCTTAGAGCAGTGTTTCTCAACCTGTGGGTCTCAGCCCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 71610217..71610451 231
 
EST/CDNA Est Name
  BY184213.1


Sequence tag IST14413C1HMR1
Sequence
GATNAAACTCGGANCCTTGTGCATGCTACACAAACACTCTACTACAAGCTGGACACCCAGCCAACAGGCACCCCCTTCTG
TGGGTGTTTTCAGTAACTGGATTTCAAGCATAAGCACATACAAGGGCAACGCAGGCAATAAGGGCAACAGTTACAGAGCA
TCTGGGTCTCACACTGGGTGGTGAATCTGCTGGGCGAACAGTTCTTGGGTTC
Sequence Type genomic DNA
Unitrap ID UNI32135

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 71610116..71610326 207
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032232 (Cgnl1) NM_026599 cingulin-like 1 Gene [Source:MGI (curated);Acc:Cgnl1-003]

 
Come back to gene ENSMUSG00000032232


For any suggestions or comments, please send an email to unitrap@crg.es