Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12102F3
Clone ID IST12102F3
Vector VICTR76
Project tigm

Sequence tag IST12102F3BBF1
Sequence
GAATGACTACTCCAGCTTGTTTCTTCTGACCNTTTGCTTGGAAAATTGTTTTCCAGCCTTTTACTCTGANTTAGTGTCTG
TCTTTGTCCCTGAGGTGGGTTTCCTGTATGCAGCAAAATGTTGGGTCCTGTTTATGTAGTCAGTCTTTTAGTATATGTCA
TTTTATTGGGGAATTGAGTCTGTTGATATTAANAGATATTAAGGAAAAGTAATTGTTGCTTCCTGTTATTTTTGTTGTTA
NAGTTGGTATTCTGTTCTTGTGGCTATCNNCTTTTANANTTATTGAANGATTACTTTCTTGCTTNTNCNGCNNCANAATG
GAGTTTTTTTTTANNTANANNNNGTTCTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12102F3HMF2
Sequence
GAATGACTNCTCCAGCTTGTTTCTTCTGACCNTTTGCTTGGAAAATTGTTTTCCAGCCTTTTACTCTGAGTTAGTGTCTG
TCTTTGTCCCTGAG
Sequence Type genomic DNA
Unitrap ID UNI32282

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20437165..20437258 90
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]

 
Come back to gene ENSMUSG00000036617


For any suggestions or comments, please send an email to unitrap@crg.es