Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14828D10
Clone ID IST14828D10
Vector VICTR76
Project tigm

Sequence tag IST14828D10BBF1
Sequence
NTCAGCTACTACTCCCACCTGCAGCTCATTCGCACAATTCTCCAACCTCAGGCAGAGCTGTCAAATAACAGTGACACATT
TCCATGGTTTTTTGGTAACAACACGAGTAGATTCTGGGACATGATGTCCATGCTTCCTCCTCCCTCCTTCTTACAGAGCT
GGAGTAGTCGGTCAATCCCCATCACTCAGGAGAGCATGAAATGGCATTCTAGTGCTAGCTTATANAAAATGGCCACCTGC
TTCTGCNATGCNCTNNCCCATCTNCNTTCNANANAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 32395455..32395722 254
 
EST/CDNA Est Name
  BY004415.1 - BY779550.1 - BQ958093.1 - BE656039.1 - CJ185081.1 - CJ186068.1


Sequence tag IST14828D10HMR1
Sequence
ACATTTGGGTACCCAAGGTCTTGCCCACATGCCCTTTCATTCTGAGTTCTTGTCAAGAAACTACAATTGATTACTATTCT
GACTAGGGACCCTTATTATCAAAAAGGAATTGGGTGACTTTTGTGGATACGGCAGAACTTGGGAGCTGAAATGGCTCAGG
TGTTGAACATTCATTTCTCATGATCCATGTTTGTGGGTGTGGGGGTGTGTGGGAAGGAGGNGAGNNGNCNAGAGCCCC
Sequence Type genomic DNA
Unitrap ID UNI16468

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 32395219..32395455 225
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024002 (Brd4) NM_198094 bromodomain containing 4 Gene [Source:MGI (curated);Acc:Brd4-003]


Sequence tag IST14828D10HMF1
Sequence
GTCAGCTACTACTCCCACCTGCAGCTCATTCGCACAATTCTCCAACCTCAGGCAGAGCTGTCAAATAACAGTGACACATT
TCCATGGTTTTTTGGTAACAACACGAGTAGATTCTGGGACATGATGTCCATGCTTCCTCCTCCCTCCTTCTTACAGAGCT
GGAGTAGTCGGTCAATCCCCATCACTCAGGAGAGCATGAAATGGCATTCTAGTGCTAGCTTATAGAAAATGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 32395454..32395685 232
 
EST/CDNA Est Name
  BY779550.1

 
Come back to gene BY779550.1


For any suggestions or comments, please send an email to unitrap@crg.es