Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14499D1
Clone ID IST14499D1
Vector VICTR74
Project tigm

Sequence tag IST14499D1BBF1
Sequence
CAGCCTANTCNACAAAGTGAGTTCCANGACAGCCAGGGCTATACAGAGAAACCCTGTCTCNAAAAACAAACAAAAAAAGA
ATGCCTACCTCCCCTTGGCTCACATTGGAATGCTTAGTCNCCAGGGAGTGGAGCAGGATTATAATGGAGTGGCCTTGGTG
AAGGAGGTGTGTCACTATCANTGGGCTTTGANATTTCAAAANTCCATGCCAGGCCCAGTCTCTCCCCTCTTCTCTCCCCT
CCTCTCCCTTCTCCTCTCTGTCTCTGTGTCTCTTTGTGTGTGTGTGTGTGTGTGTGTNTNTGTGTNNNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 63972664..63972968 285
NO GENE  


Sequence tag IST14499D1HMR1
Sequence
GGCTGGCCTTGAACTCAGAAATCCACCTGCCTCTGGCACGAGGTGGGCATTCTTATTCNAAGCACCATACTATTGCTGTG
ATAAAACACCAGGACCAAAAGCAACTTAAGCAGGGCAGGAACCTGGTGGCAGGAGCTGATGCAGAGGCCATGAAGAGGTG
CTACTTACTGGCTTGCTTCCCATGGCTTGCTCAGTCTGCTTTCCTACAGAACCTAGGACTACCACCTTACAGGTGGCCCC
ACTCACAGTGGGCCAGGCCCTCCCTCACCAATCACTAATTAAAATGCCCTGCAGGCTTGCCTAAACTGGCTCTCANGGAA
ACCTTTTCTCANCTGANGTTCCCTCCTCTCTGATGACANCNNCTGGTGTCAAGTTC
Sequence Type genomic DNA
Unitrap ID UNI31984

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 63972964..63973338 361
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032401 (Lctl) NM_145835 lactase-like Gene [Source:MGI (curated);Acc:Lctl-001]


Sequence tag IST14499D1HMF1
Sequence
CAGCCTAGTCTACAAAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGAAACCCTGTCTCGAAAAACAAACAAAAAAAGA
ATGCCTACCTCCCCTTGGCTCACATTGGAATGCTTAGTCACCAGGGAGTGGAGCAGGATTATAATGGAGTGGCCTTGGTG
AAGGAGGTGTGTCACTATCAGTGGGCTTTGAGATTTCAAAAGTCCATGCCAGGCCCAGTCTCTCCCCTCTTCTCTCCCCT
CCTCTCCCTTCTCCTCTCTGTCTCTGTGTCTCTTTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTNNNCNNNNATANNNN
TCTCTCTCTCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 63972639..63972968 308
 
EST/CDNA Est Name
  CX734541.1

 
Come back to gene CX734541.1


For any suggestions or comments, please send an email to unitrap@crg.es