Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11237E1
Clone ID IST11237E1
Vector VICTR76
Project tigm

Sequence tag IST11237E1BBF1
Sequence
TTACCACTCCTGGTTCGATTCCCAGCATCCATCTGTNACTGTANCTCATGAAGGAAGCTCACTACCTTCCTCATGCTGTG
GTGACCCTAGTCATAAAATAATTTTTGTTGCTGTTTCATAACTACAATTTGTTACTGTTATGAACTGTAATGTAAATGTC
TGTGTTTTCCAGTGGTCTTAGGTGATCCCTGTGAAAGGGAACCATTTGGAGTTCTACCCCAGAAGGGGGACCCACAGGTT
GAGAGCCGCTATCTTTATGTCCAGGANATCTG
Sequence Type genomic DNA
Unitrap ID UNI29695

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 34930792..34931061 264
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029106 (Add1) NM_013457 adducin 1 (alpha) Gene [Source:MGI (curated);Acc:Add1-002]


Sequence tag IST11237E1HMF1
Sequence
TTACCACTCCTGGTTCGATTCCCAGCATCCATCTGTCACTGTANCTCATGAAGGAAGCTCACTACCTTCCTCATGCTGTG
GTGACCCTAGTCATAAAATAATTTTTGTTGCTGTTTCATAACTACAATTTGTTACTGTTATGAACTGTAATGTAAATGTC
TGTGTTTTCCAGTGGTCTTAGGTGATCCCTGTGAAAGGGAACCATTTGGAGTTCTACCCCAGAAGGGGGACCCNCANGTT
GANAGCCGCTATCTTTATGTCCNGGANATCTTGGTACCTGTGGTTCTGTGCATACATCCCTGCCCCCNATGGATTGTTAT
TGTTGTTTTGAGACAGAGTTTCTCTGTGTANCCCTAACTGTCCTCTAACTCACTCTGTANACCANGCTGGCCTGGAACTC
NNNNGATCCTCCTGCCTNTGTCTCCTGANNNCCGGGATTAAAGGTGTACGCCACCACTGCCTGGCTGGAATTTATAAAAA
TTTNNAGAAAATGGGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000029106


For any suggestions or comments, please send an email to unitrap@crg.es