Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14503A7
Clone ID IST14503A7
Vector VICTR74
Project tigm

Sequence tag IST14503A7HMF1
Sequence
CCATCACCTGTTTGTATGTTTTTTCCTCTTTTTCTGTAAGGACTTCTACCTGTTTGATTGTGTTTTCCTGTTTTTCTTTA
AGGACTTGTAACTCTTTAGCAGTGTTCTCCTGTATTTCTTTAAGTGATTTATTAAAGTCCTTCTTGATGTCCTCTACCAT
CATCATGAGATATGCTTTTAAATCTAGGTCTAGGTTCTCAGGTGTGTTGGGGTCCCCTGGACTGGGCGAAGTGGGTGTGC
TGGGTTCTGGTGATGGTGAGTGGTCTTGGTTCCTGTTAGTAAGATTCCTCCGTTTACCTTTCGCCATCTGGTAATCTCTG
GAGTTANTANTTATAGTTC
Sequence Type genomic DNA
Unitrap ID UNI28018 UNI33670 UNI33671

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 35979993..35980330 334
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055453 (A830019P07Rik) RIKEN cDNA A830019P07 gene Gene [Source:MGI Symbol;Acc:MGI:3028035]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 59275866..59276203 334
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 35443102..35443439 334
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022844 (Pdia5) NM_028295 protein disulfide isomerase associated 5 Gene [Source:MGI Symbol;Acc:MGI:1919849]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 65890171..65890508 334
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 59208222..59208559 334
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055254 (Ntrk2) NM_008745 neurotrophic tyrosine kinase, receptor, type 2 Gene [Source:MGI Symbol;Acc:MGI:97384]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 14003582..14003919 334
 
EST/CDNA Est Name
  BF642808.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 16286633..16286970 334
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 16370602..16370939 334
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 78938454..78938791 334
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 64049326..64049663 334
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 71740337..71740674 334
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 52239968..52240305 334
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 69929916..69930253 334
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 46983737..46984074 334
NO GENE  

 
Come back to gene BF642808.1


For any suggestions or comments, please send an email to unitrap@crg.es