Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14555H4
Clone ID IST14555H4
Vector VICTR74
Project tigm

Sequence tag IST14555H4HMR1
Sequence
NTGGTTTTAGCTCCCTTGTCAAAGATCAAGTGACCNTTGGTC
Sequence Type genomic DNA
Unitrap ID UNI31449 UNI35535 UNI35727 UNI35728

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 43296905..43296944 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 44900816..44900855 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062082 (Cd200r2) NM_206535 CD200 receptor 4 Gene [Source:MGI (curated);Acc:Cd200r4-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 20873084..20873123 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 5965489..5965528 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 82336450..82336489 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 91860390..91860429 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 53101960..53101999 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 20597860..20597899 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060508 (Nlrp9b) NM_194058 NLR family, pyrin domain containing 9B Gene [Source:MGI (curated);Acc:Nlrp9b-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 61930737..61930776 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066152 (Slc31a2) NM_025286 solute carrier family 31, member 2 Gene [Source:MGI (curated);Acc:Slc31a2-003]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 106691474..106691513 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 78775430..78775469 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 22779076..22779115 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026784 (Pdss1) NM_019501 prenyl (solanesyl) diphosphate synthase, subunit 1 Gene [Source:MGI Symbol;Acc:MGI:1889278]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 6554637..6554676 38
NO GENE  


Sequence tag IST14555H4BBF2
Sequence
ATCCNNNGGAAAAAAGACAGCNNNNNGAACAAATGGTGCCGGCACAACTGGTGGTTATCATGTAGAAGAATACGAATTAA
TCNNNNCNTATCTCCTTGTACAAAGCTCANNNCNAANNGGATCAAAGACCTCCACAAAAGACCAGAGACACTGAAATTAA
GAGGAGANNNNNNGGAAAAGCCTCGAAGATATGGGCACAGGGGGAAAATTCCTAAACAGATCAGCAATGGCTTGTGCTGT
AAGATCAAGAATTAACAAATGGGACCTTATAAAATTGCAAAGCTGGGCTGGTGAGATGGCTCAGTGGTTAAGAGCACCGA
CTGCTCTTCTGAAGGTCCTGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCACCCGTAACAAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000026784


For any suggestions or comments, please send an email to unitrap@crg.es