Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone DC0628
Clone ID DC0628
Vector pGT1lxr
Project sanger

Sequence tag DC0628
Sequence
CGTTTTTCGAGACAGGGTTTCTCTTTATAGCTCTGGCTGTCCTGGAGCTCACTTTGTAGACCAGGCTGGCCTCGAACTCA
GAAATCCGCCTGCCTCTGCCTCCCGAGTGCTGGGATTAAAGGCCCCACGCTCATCCCACCTTACCCATACTAATTGTCCC
TCATTGCGTCTCACAATACCGCCTTGCACTATTCCCGCTCTCCGTTTACACCGTCCCTGACTTGCCTGCGTCCCCTGGCT
GTCCCGCCCCGCCCCGCCCCCGGCCTGCAGGGCGCGTGAAGTTCGCAGCGCCCGGGAGGAGAGAAGACGGGCGGCGTGCC
ATGGCGGTCGCGCTCCCGGAGGTGGTGGAAGAGCTCCTGAGCGAGATGGCCGCCGCTGTGCGAGACAGCGCGAGAA
Sequence Type genomic DNA
Unitrap ID UNI3041

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62094759..62375174 156
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014243 (2410012H22Rik) zinc finger, SWIM-type containing 7 Gene [Source:MGI Symbol;Acc:MGI:1916997]

 
Come back to gene ENSMUSG00000014243


For any suggestions or comments, please send an email to unitrap@crg.es