Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15014C7
Clone ID IST15014C7
Vector VICTR78
Project tigm

Sequence tag IST15014C7BBF1
Sequence
GGCCTAAAGCCTGTTTTTCCACTTGTCCCTACAAGCAAGTCACACACAGTGCCTGCTTTCTTCTGTATAANGCATTTGGT
AAAATATAAATAAATAAACNATATGGTATGANTTTGGTGCANGGANNAATCANTGCTCTTAAAAATCTCCAAAANAAAAA
T
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST15014C7HMR1
Sequence
TANTTTGGTCTTGTAAGGATCTATTCCTTTAAAATATAGTTATATCTTANTATATCGTTGTATTTCAAGGTTC
Sequence Type genomic DNA
Unitrap ID UNI26294

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 121498823..121498894 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028127 (Abcd3) NM_008991 ATP-binding cassette, sub-family D (ALD), member 3 Gene [Source:MGI Symbol;Acc:MGI:1349216]


Sequence tag IST15014C7HMF1
Sequence
GGCCTAAAGCCTGTTTTTCCNCTTGTCCCTACAAGCAAGTCACACACAGTGCCTGCTTTCTTCTGTATAAAGCATTTGGT
AAAATATAAATAAATAAACAATATGGTATGAGTTTGGTGCAGGGATTAATCATTGCTCTTAAAAATCTCCAAAAAGAAAA
GTTGTAGCGGGGCAGTAGTANCACACGCACGCCTGTNATCCCAGCACTTANGANANNNANGCNGGTGGATTTTTNNNTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000028127


For any suggestions or comments, please send an email to unitrap@crg.es