Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13052B6
Clone ID IST13052B6
Vector VICTR76
Project tigm

Sequence tag IST13052B6HMR1
Sequence
CTCAACCTGTTCGGGTAGGGGATGTCTGGTGCACTTTGTCNTCTNTGCTCTN
Sequence Type genomic DNA
Unitrap ID UNI26976

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 57431632..57431682 47
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031139 (Mcf2) NM_133197 mcf.2 transforming sequence Gene [Source:MGI (curated);Acc:Mcf2-001]


Sequence tag IST13052B6HMF1
Sequence
AAGGAGGGAGCCGGGAAGAGGGGAGAGAGCCCAGTGTTCCAGGCAACTGAGTGGGAGTGCACAGGGATGTGGTACTCACC
TGCTANGAAGACTGCCTGCANCAAGCANAGGTANTTCTTCCCGTACTTCTCCGCGATCCTAACGCGATGCANGGCCATGG
A
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 57431681..57431839 149
NO GENE  

 
Come back to gene ENSMUSG00000031139


For any suggestions or comments, please send an email to unitrap@crg.es