Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10088G7
Clone ID IST10088G7
Vector VICTR75
Project tigm

Sequence tag IST10088G7BBR1
Sequence
AAAGATTTATTTATTATTTGTAAGTACACTGTAGCTGTCTTCAGACACACCAGAAGAGGGCATCAGATCCG
Sequence Type genomic DNA
Unitrap ID UNI33589

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 59039653..59039721 69
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055254 (Ntrk2) NM_008745 neurotrophic tyrosine kinase, receptor, type 2 Gene [Source:MGI Symbol;Acc:MGI:97384]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 77964690..77964758 69
NO GENE  

 
Come back to gene ENSMUSG00000055254


For any suggestions or comments, please send an email to unitrap@crg.es