Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14773A7
Clone ID IST14773A7
Vector VICTR76
Project tigm

Sequence tag IST14773A7HMR1
Sequence
ATATNATTAGATCTGCTTTCTTCTATTCTTTCTGTTTACCTAGGCATTAATGAGAAGTGTAAAATGGAATCCTAATAGCA
ACCTTACACTACCAGANGCTTCGAGTCTGAGGTAAGCCTGCCACTCTGCAGGCTTGGTTTAAGGAATAATTANTAATAAG
GAGAAATTTTATCTCGGTCCCGCACAGCCATAATATTCAGAGGTCANTACTGTGTGTACTTATATATAGTTGAAGGGAAA
CCTAAAACATTATTTGACATTAGGTAATTTTTAAAGGAGCCNTTTGCTANCAANANCANATTTAANCTGAGTTTAAAGAG
TGCGTTGCANGGCANTTCCTAANGGTAACACTTTAACTGTGGATACNANCCCACGGTGCACAGACTCTCTGANNAAACTG
GAATGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14773A7HMF1
Sequence
ATATAAACAGAAGGCGTAGTTAGCTCATAACCTTAGAGAACCAACCCCTAGCTTTGAATAATTAATTAGAATTGTTACTA
TGGTAAAATTTTAGTTCACATAATTTCTATCCAGGGGCACTTTCATTCTCTGCTGGGTCAGGGCTAAAATGTCTGTCTCG
TTATTATTTATTTATTTTTTTGAAAGCAGTTTTGGCTCATCTGATACTAATTCTAGAGACTTTCTTGTTGCCTTCGAAGC
CTTTGGAATTTTTAGCATGAACTAAGCTGTCTGTTGGGGTGGAGCAGCCAAGCAAACAGGTACCCCANTCCCTCCCAGGA
CNAGGGTCTTCAAGCCANATTCCCTATAGAGTAACAAAAATCTCTCAGCAAAGACCCTCCTCTTTCACGGTGCCAGGATC
ATGGGAAGTNNCNNTTTANNNANGTTTCACACCTGTGCN
Sequence Type genomic DNA
Unitrap ID UNI29755

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 59538678..59539116 413
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035168 (Tanc1) NM_198294 tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 Gene [Source:MGI (curated);Acc:Tanc1-001]


Sequence tag IST14773A7BBF1
Sequence
NATAAACANAAGGCNTAGTTAGCTCATAACCTTAGAGAACCAACCCCTAGCTTTGAATAATTAATTAGAATTGTTACTAT
GGTAAAATTTTAGTTCACATAATTTCTATCCAGGGGCACTTTCATTCTCTGCTGGGTCAGGGCTAAAATGTCTGTCTCGT
TATTATTTATTTATTTTTTTGAAAGCAGTTTTGGCTCATCTGATACTAATTCTAGAGACTTTCTTGTTGCCTTCGAAGCC
TTTGGAATTTTTAGCATGAACTAAGCTGTCTGTTGGGGTGGAGCANCCAANCAAACAGGTACCCCACTCCCTCCCAGGAC
CAGGGTCTTCAAGCCAGATTCCCTATANAGTAACAAAAATCTCTCANCAAAGACCCTCCTCTTTCACGGTGCCNGGATCA
NGNNAANTNNCANTTNANAAGANGTTTCANACCNGTGCNNGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000035168


For any suggestions or comments, please send an email to unitrap@crg.es