Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12129C3
Clone ID IST12129C3
Vector VICTR76
Project tigm

Sequence tag IST12129C3BBF1
Sequence
AGGCTGGGCTAAAGAGTGGGGTTTGGTCTCGAAACAACAAAACAGCAAGAGTTTGTGGAATTAATGTTGAAATGACAGTC
GGATGTGGG
Sequence Type genomic DNA
Unitrap ID UNI20020

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4706931..4707018 88
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009073 (Nf2) NM_010898 neurofibromatosis 2 Gene [Source:MGI (curated);Acc:Nf2-001]

 
Come back to gene ENSMUSG00000009073


For any suggestions or comments, please send an email to unitrap@crg.es