Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13102A11
Clone ID IST13102A11
Vector VICTR76
Project tigm

Sequence tag IST13102A11BBF1
Sequence
TTTGTGTGCACAGGTATGAAAGCTTTCAATTTGCCAGCAAGGGACAGGGACAGATTTGGCATACCCTTAATATCCACTGC
CTTTCCCTTCTGTCCCAGAGACTGGTTCCTGTGCAGGCCTTTGCAGAGTGCTATAAGAGAATCGAGTAAGGCTTCACTTG
TTGACTGCTGGGGGCTGTGATACCTGGAGGGAAGACACTGACCCAGCCTAGGGGCATCAGAGCTGAGAGCAGGATATCCT
GGACGCGTGATTTGAGGAAGGATTTCCCTAGCTCACTCCTGAAGGCAGTTTCATGAGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI14986

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 60024491..60024790 300
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020538 (Srebf1) NM_011480 sterol regulatory element binding transcription factor 1 Gene [Source:MGI (curated);Acc:Srebf1-005]


Sequence tag IST13102A11HMF1
Sequence
TTATAAGCTTCTCCTCTGCCCCTAGCAACCAGAGACCAGCAGCAAGCTCATGATGGAGTTTATAGTGGCCCCTCANCATC
ACTTANCATCAAGTCAAGAGTANTCTATTTCAAGGTGCTAATCAGCCAGGCAGTCTGTCGAAGTTGGA
Sequence Type genomic DNA
Unitrap ID UNI14434

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 92040805..92040950 140
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058318 (Phf21a) NM_138755 PHD finger protein 21A Gene [Source:MGI (curated);Acc:Phf21a-002]

 
Come back to gene ENSMUSG00000058318


For any suggestions or comments, please send an email to unitrap@crg.es