Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14174A7
Clone ID IST14174A7
Vector VICTR74
Project tigm

Sequence tag IST14174A7BBF1
Sequence
AGGAGAATCCCTGGGGCTTACTGGCCAGACAGACCAGATGGATGGGTGAGCTCCAGAGAAGAGAGAGGTCTGGTATCAAA
AAAGATAAGAGTTCCAAGGATAGCAACTCATGTTGTCTACTATCCTCCACATGTATGCACACACACATGAATATGGACCA
ACACACATGCAACCACAGCCATAAGCATACACATGTACGTTTCATCTAAGACATAGGTTATTATTCCCAGTTCTCAAATG
GAACCTGGTACTTTGTTCATGGTAGGCAAGTGTTCTACCACAAAGTAGATCCCATCCAATACATTTCTTCCCTGCCTTAG
ATCAGACTGGGTTAAGTTTCTATCACTCACAGCTCAGATTGTAGCAGCAAGAGAGACTCAGGACCTTATCCAAAGTCNCT
CAACAGGTTAGCCACAGAGACATGGCCACTGTCAGANTCAGCCCCATCTGCTGCTCANCCTGGTCAATCCGGGGATAGAG
TGAGCTGANATAANGGACAGANAAGNNNCAATGGTTGGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 32677374..32677896 501
 
EST/CDNA Est Name
  BE949105.1


Sequence tag IST14174A7HMR1
Sequence
TCCTATCTCTACCTTNNNCNNGTAGCAACAGCATACAAACATTTAAAGATATTTATTTTTGAGGCCATTATTTATTATTT
TGAGATATTTTGTAGCTCTAGGTGACGTGGAGTCCACTTTATAGACAAGGCTGATCTAGAACTCACAGAGACCCACCTTT
GTCTGCCTCCTGAGTGTTGATATTAAAGGCATGTTCTACCATGTCCAACATTTATCTTTAATTTATGAATGTTTGCCTGT
ATGGATGAATGGGTACCCCATGTATGCAGGACCCCCAGTGGA
Sequence Type genomic DNA
Unitrap ID UNI35735

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 32677893..32678174 268
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048440 (Cyp4f16) NM_024442 cytochrome P450, family 4, subfamily f, polypeptide 16 Gene [Source:MGI Symbol;Acc:MGI:1917351]

 
Come back to gene ENSMUSG00000048440


For any suggestions or comments, please send an email to unitrap@crg.es